Human is an ancient retroviruse that causes leukemia

Human T cell
lymphotropic virus type 1 (HTLV-1) is an ancient retroviruse that causes leukemia
and the neurological disorder HTLV-1 associated myelopathy or tropical spastic
paraparesis (HAM/TSP). although HLTV-1 infection distributed globally but some
regions are endemic. Despite the virus has a conserved genome, molecular
epidemiology on human movement and transmission pathways has been useful for
determining the tome of introducing the virus into countries. In current study,
we analyzed the genetic variability of LTR region of infected individuals lived
in Mashhad. Sequencing and comparison analysis from different HTLV-1 isolates
showed 0.8% to 1.2%. variability in genome. Phylogenetic studies let us to
include these isolates in the transcontinental subgroup A in which samples
isolated from Torbat-e-heydariyeh and Neyshabur are also found. Further Phylogenetic
analysis will provide insight into genetic
heterogeneity and help to understand the history, evolution, origin and spread of HTLV-1.

Key words: human T cell
lymphotropic virus type 1 – HTLV-1 associated myelopathy/tropical spastic
paraparesis – HTLV-1 phylogeny – Mashhad

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

introduction

Human T-lymphotropic virus type 1(HTLV-1) is the first known retrovirus causes HTLV- associated myelopathy/tropical spastic paraparesis (HAM/TSP) and adult T-cell leukemia (ATL) disorders(2, 3). In addition, the virus is considered to be contribute in various inflammatory diseases most notably uveitis, arthritis, myositis and alveolitis (2-4). Although the distribution of HTLV-1 is global, but the higher rates of infected individuals have been observed in southern Japan, Africa, the Caribbean, South America (5) and more recently Iran ; a region with an increasing rate of HTLV-1 cases (6). In these regions, between 0.5 and 20% of the general population have HTLV-1 antibodies and are considered to be healthy carriers(7). Most of HTLV-1 infected individuals remain asymptomatic carriers (ACs) through their lives and in a few subjects HTLV-1-associated diseases will develop(8). The first infected adults were detected by Farid in 1993 with 2.1% prevalence, an ancient populous city with more than 25 million pilgrims and visitor annually.

On the molecular level, HTLV-1 genome is
very stable. HTLV-1-genome show a low degree of genetic variation (0.5 to 3%)
and high identity in nucleotide sequences among HTLV-1 strain (13, 14). Moreover, disease-specific sequences
have not been found for HTLV-1 associated diseases, Instead the genomic
variability of HTLV-1 appears to depend on geographic origin more than the
pathology.

MATERIALS AND METHODS

 

HTLV-1-infected
samples whom clinical diagnose of HAM/TSP /ATL and ACs were participated in this study. These
specimens were chosen from volunteers who were referred to Department of
Neurology at the Ghaem Clinic after confirmation tests. All ACs were diagnosed
as HTLV-1 carriers at the time of blood sampling. Serum samples
were tested for detection of anti-HTLV-1 and 2 antibodies using ELISA method,
then positive results were confirmed by PCR using the primer targeted Tax gene.
Moreover, we explained
all the goals and methods of the study briefly for our patients and came to an
agreement to obtain written informed consent. Briefly, 6 ml blood samples were obtained
from 15 infected individuals living in Mashhad. Peripheral blood mononuclear cells (PBMCs) were separated from
blood samples by using ficoll method. DNA was extracted from PBMCs using the DNA Genomic
Purification Kit (Blood mini kit, Qiagen, Germany) according to protocols recommended
by manufacturer and samples were stored at ?20 ?C.

Thereafter, Polymerase
chain reaction (PCR) was performed on seventy nanograms of DNA to amplify complete LTR region approximately 780bp long and
corresponding to position 60 to 830 in ATK-1, the prototype Japanese HTLV-1 strain, using one set of overlapping oligonucleotide
primers designed by Geneious software 9.0.5. LTR-A forward (5?
TAGAGCCTCCCAGTGAAAAAC -3?), LTR-B reverse (5?-TTTGGGAGTAGGCTGGCTAG -3?).
Assembling all reactions components for PCR amplification was carried out on
ice and quickly transferred reactions to a thermocycler preheated to the
denaturation temperature 95°C. The procedure was done in a 25 ul volume that
contained 25M MgCL2 -1.5ul, 10M dNTPs -0.5ul, 10× Reaction Buffer-2.5, 0.5ul
Prime Accupol™ DNA Polymerase, template DNA 2ul, 0.5 ul of each specific
primer, 17 ul dH2O. The PCR machine (Astec PC700, Kyoto, Japan) using an
initial denaturation step at 95°C for 5 minutes, followed by 30 cycles of 95°C
for 30 seconds and 60°C for 30 seconds, 72°C 1 minute and a final extension of
72°C for 5 minutes. Gel was stained by ethidium bromide, then electrophorese on
2% agarose gel with molecular-weight size marker and a sample (5 ul) of each
amplified product were conducted in TAE buffer (Tris-acetate EDTA) at 70V for
30 minutes and visualized under UV light.

 

Cloning and sequencing of the amplified LTR
fragment 

 

PCR products were purified using GeNet Bio Gel Extraction (GeNet bio).
The amplified LTR region fragments were cloned into pTZ57R/T vector using TA
cloning method. The plasmid was extracted by using a plasmid purification kit
generally, one clone per amplification products were sequenced in both
directions by Macrogen (www.macrogen.com).
Sequences were then analyzed using Geneious software and compared with the HLTV
ATK-1 prototype (accession number J02029)

 

Results

 

The studied groups consisted of 15 confirmed HTLV-1 infected adults whom clinically diagnosed with HTLV-1 associated disease, it was possible to
amplify a fragment of the expected size of 767 bp with designated primers LTR-A
and LTR-B. Almost HTLV-1 LTRs of all DNA specimens were completely sequenced.

Sequence analysis – We therefore purified a 767 bp segment (Fig. 1) from all samples.
The amplified fragment from these samples was cloned into the pTZ57R/T cloning
vector and one clone per amplification products were sequenced in both directions by
Macrogen (www.macrogen.com). Obtained
sequences from the samples showed the trustworthy of amplified fragments with homogeneous
population of PCR products, and the variations observed were as a result of
alternations in viral genomic sequences linked to the geographic origins. Thus, most of the diversity in
local strains were not known to inhibit viral expression or replication. In order to obtain information concerning LTR nucleotide
diversities, all the collected sequences were compared with the equivalent sequenced
derived from different regions of Khorasan province and other endemic areas. Sequence
analysis revealed that the 13 nucleotide sequences from patients were exactly
identical and showed no significant differences within studied group. The exceptions to this general
pattern were two alternations in HAM/TSP85 samples (A285 to
C, A541 to G) and one
alternation was in an ATL 90 case at position C696 to T, which
is located in the R and U5 regions, respectively. LTR alignment from isolates showed 99.7-100% similarity
amongst the sequences. These nucleotide variations may be primarily a result
from their low fidelity related to the reverse transcriptase enzyme.

Nucleotide alignment were carried out among sequences
and compared with the sequences of the HTLV-1 strains from various geographic distant
regions including Japan (ATK- 1, H5, TSP-1, MT-2; Seiki et al. 1983, Gray et
al. 1990), the Caribbean area (HS-35, CH; Malik et al. 1988, Ratner et al.
1991), Brazil (pt-8; Schultz et al. 1991), Romania (H990; Schultz et al. 1991),
Melanesia (MEL-1; Gessain et al. 1993), the United States (SP; Paine et al.
1991), a variant from Gabon (GeneBank Accession number L33266; Moynet et al.
1995), Chile (ST; Dekaban et al. 1992) and Zaire (EL; Paine et al. 1991, Ratner
et al. 1991), as well as the sequences of human T-cell lymphotropic virus type
I from Torbat-e-Heydarieh and Neyshabur from Khorasan provinces (Watanabe et
al. 1985) and sequences of HTLV-1 strain Mo from the United States (Shimotohono
et al. 1985).

Alignment of the sequences of the 767bp segment of
the Japanese HTLV-1 strain ATK-1 (Fig. 3), with sequences from this study exhibited
a 1.5-2.4% dissimilarity. The variability among the
sequences obtained from the Mashhadi strains was 0.5%. The nucleotide sequences
for this fragment showed that there are alternations in nucleotide G36 to
A, C37 to
G, G172 to
A, A241 to G, represented
a distinctive feature of the local isolates when compared to the ATK-1 strain. Despite this overall
low degree of genomic variability in nucleotide sequence, no nucleotide variations were observed in the poly(A) signal
(AATAAA), the TATA box and the CAP site, comprising nucleotide 88 to 98 on the LTR gene, was totally conserved between the HTLV-
1 Mashhadi strain sequences Office1 examined here.

Phylogenetic analysis –  The
phylogenetic trees constructed were very similar by two different methods (UPGMA, NJ) using the 767 bp LTR gene.
Although similar, we selected
the NJ method because it provided the most illustrative phylogenetic tree. As
shown in Fig. 4, three main groups were clearly identified. In the
first group appeared strain ptM3 of HTLV-1 that represents an early ancestor
from which the Melanesian and cosmopolitan strains diverged, whereas in the
second group appeared the Melanesian MEL-1 strain. The third group or
cosmopolitan subgroup appeared clearly separated from the African and
Melanesian groups and contained the Mashhadi strains described here and distinguishable from reference sequences for groups B, C, D, E, F,
and G. Office2 

Our results suggest that these Mashhadi isolates can be clustered
with the same group as other Khorasan province and Iran isolates such as Mashhadi
jew and Mashhadi immigrant patient to German with the same clade with cosmopolitan (a) subtype. Although the analysis shows that
the strains from Japan and Africa seem not to be in the same branch as the
strains described here Mashhad, they do not form a completely separate
subgroup. Office3 

The sequences
were submitted to Gen Bank after analysis: BankIt1824992 HTLV-1_LTR (Torbat-e Heydarieh __Iran)
KR819400

 

 

Fig. 1.
Alignment of the nucleotide sequence of the LTR from different HTLV-I isolates.
Only those changes observed with other published sequence are mentioned.
Nucleotide positions are numbered according to the ATK-1 prototype sequence
starting from the first LTR nucleotide (14). Points represent
homologies. 13 HTLV-1 –LTR local isolates were identical. HAM/TSP85 and ATL90
were the exceptional.

Discussion

There is close
relationship between the phylogenetic HTLV-1 genotypes and the geographical
origin of infected- individuals, although up to date the significant
correlation exists between diversities observed in geographical origins and
clinically pathology outcomes are not well identified. HTLV-1 phylogenetic
studies of different ethnic groups are helpful because it assists to identify the
probable time of introducing and spreading the different HTLV-1 strains into countries
and investigate the possible origins of HTLV-1 in endemic areas during mobility
of human populations. These proofs confirm the nucleotide heterodiversities
observed in different HTLV-1 strains. Here, we define the full-length sequence
of LTR region of infected individuals lived in Mashhad, a populous town where
the most Caucasians residents have different economic,
social, health and cultural background in northeast of Iran. Mashhad has higher level of HTLV-1 antibodies in blood
donors as compared to that blood donors from different provinces of Iran and
the prevalence of HTLV-1 in one of the highest in Asia. Seroprevalence studies conducted
between 2005 to 2013 indicated low prevalence of HTLV-1infection in different
provinces in Iran (Azerbaijan, Ilam, Hormozgan, and Bushehr, the percentages of
blood donors with the virus were 0.34, 0.21, 0.18, and 0.01% respectively,
suggesting an unseen threat for the public health. So, it is necessary to educate and
increased awareness concerning the sexually/blood transmitted diseases or transition pathways in general
population to decreased the number of new
infections.

 

From 15
confirmed samples who had been clinically diagnosed HTLV-associated diseases, 5
patients were ACs, 5 patients were ATL and 5 infected adults were HAM/TSP that
were recognized as HTLV-1 positive by two certain different serology methods. Analysis
of sequences indicated that all sequenced LTR showed an identical pattern in
nucleotide sequences among samples from Torbat-e-heydariyeh. The nucleotide
pattern observed among samples permitted us to primarily assume the presence of
variation in the sequence which was specific of certain geographical origin as
compared to the isolate ATK-1 (GeneBank accession numbers J02029).

For the phylogenetic studies and
ascertain genotype, The LTR region was selected because the certain
noncoding and theoretically nonfunctional regions of the LTR, specially
the U3 fragment, are useful for viral
subtype characterization because of highest variability rather than other
regions of the virus (14) while other regions of LTR that initiate
transcription, polyadenylation and spicing have more constant region.
For this purpose the current study focused on 767 base pair fragment of the LTR
gene, to analyze the genetic similarities in fifteen of the isolates specimens
since such a gene initiates transcription,
polyadenylation and splicing. We, and other ( Rafaat panah) have observed G36 to
A, C37 to
G, G172 to
A, A241 to G,
when compared to the ATK-1 isolate as a reference. By aligning the sequences of
the reference strains and sequences from isolates of current study with other
HTLV-1 sequences of geographically distant strains, they indicated considerable
similarities in nucleotide sequences when compared to the ATK-1 prototype
strain. Nucleotide similarity was: T (Chile) 0.8%, pt-8 (Brazil) 0.8%, ATK-1,
MT- 2, TSP-1, H-5 (Japan) 1.2– 2.3% and CH (Caribbean) 1.4%. However, Low evolutionary, constant genome
and high similarities in sequences have been reported for each HTLV-1-patient
by molecular epidemiology, but up to date no specific-disease nucleotide
variations recommended to develop ATL or HAM/TSP from virus carriers. So, geographical
origin, transmission routs, host genetics seem to associate with clinical
symptoms. Along with previously studies, on the molecular level, HTLV-1 have
shown low drift of diversities in nucleotide sequences amongst
HTLV-1 isolates in Sabzevar and other endemic populations. Thus, the diversities observe in nucleotide among HTLV-1 strains representing the close
correlation with geographical origin of the HTLV-I strain than the pathology.

To validate the trustworthiness of
the topology of the phylogenetic tree constructed, different methods such as
UPGMA and NJ were used. Data analysis indicated that it is likely to observe local
isolates are closely related to isolate from Torbat-e-heydariyeh, Sabzevar and
Neyshabur and all the strains studies here belong to the Cosmopolitan group. In
this examination is also possible to notice that the Japanese strains MT-2, TSP-1 as well as strains EL
from Zaire, a variant from Gabon, and HS-35 from the Caribbean area
cluster with the different group. This finding is in agreement with other studies conducted in
different geographical suggested that the Cosmopolitan subtype was found to be
widespread. Similarly, Cosmopolitan type was observed in the Reunion Island,
Iranian-born Mashhadi Jews and Kuwaiti HTLV-I isolates, strongly suggesting the
common origin of all these isolates.

Several lines of proof here
suggested that spreading of HTLV-1 infection through American continent
initiated with the first human population movement. in contrast, other
phylogenetic analysis revealed that the origin of all HTLV-1 subtype is Africa,
according to the absence of HTLV-1 among Amerindians and the high prevalence of
infection among individuals of African descendent in the Caribbean area and in
South America. It is possible that HTLV-1 was brought to Mashhad by African slave
immigrants as suggested by felani. These researchers propose that HTLV-1
originated in region called an Indian Malayan, from there apparently distribute
to Africa by marines thousands of years ago, and that later due to slave trade
in the XVI century, it spread to the New World and Iran. An analysis of the LTR
region of HTLV-1 isolates from different ethnic groups of endemic regions have suggested that the virus
may have been introduced into Iran on a number of occasions from several
African heredities, probably during and after the slave trade or through recent
Mongoloid invasion when
the city served as an important crossroad and trade center (Van Dooren et al. 1998). HTLV-1
is predominantly frequent among descendants of African slaves.
Amongst these hypothesis, Slavery seems more likely to have introduced the
virus to these cities, because it has been commonly performed even before the
rise of Islam in these cities. As a consequence of increased human mobility, HTLV-1a infection has also reached different Iran’s neighbors, such as
Pakistan, turkey, Saudi Arabia, whereas HTLV-1 is still uncommon in the general
population. Furthermore, the social
interaction among countries such as international trade, tourism, and
pilgrimage seems to be playing a central role in virus dissemination. Phylogenetic
analyses of the LTR region in the virus isolates examined here as well as in
strains from different ethnic groups in Iran’s neighbors will make it possible to confirm the
origin of the HTLV-1 strains in these populations and to determine the exact time
of introduction of viral strains into Iran especially Mashhad.

 

 

 

 

 

 

 

 

 

 

 

 

 Office1Masaln
migi nigah kardam hich taghiri dar u3 ya felan ya felan moshahgede nakardam

 Office2Kamelan
ba Mehran sohbat kon

 Office3Ba
Mehran kamel chek kon